ID: 1035257898_1035257912

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1035257898 1035257912
Species Human (GRCh38) Human (GRCh38)
Location 7:157643694-157643716 7:157643724-157643746
Sequence CCCCCTGCAGACACCCGCACCCA GGAGGTGGGAGCAGGCGGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 33, 4: 368} {0: 1, 1: 1, 2: 13, 3: 100, 4: 889}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!