ID: 1035272362_1035272369

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1035272362 1035272369
Species Human (GRCh38) Human (GRCh38)
Location 7:157728003-157728025 7:157728031-157728053
Sequence CCCACCCTGCAGACGTCTGTGGG CCTCTCCCGTCTACACCTGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 149} {0: 1, 1: 0, 2: 8, 3: 22, 4: 103}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!