ID: 1035279267_1035279277

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1035279267 1035279277
Species Human (GRCh38) Human (GRCh38)
Location 7:157767011-157767033 7:157767057-157767079
Sequence CCTGGCACCACCTAGCACCATAC TTGCCACAGCTCCCCCTGCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 141} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!