ID: 1035301850_1035301865

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1035301850 1035301865
Species Human (GRCh38) Human (GRCh38)
Location 7:157902410-157902432 7:157902452-157902474
Sequence CCAGCCCCGCGGTGGCCTGGAGA GCGGTGGCCTGGAGAGTACGTGG
Strand - +
Off-target summary No data {0: 2, 1: 2, 2: 3, 3: 11, 4: 129}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!