ID: 1035301888_1035301893

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1035301888 1035301893
Species Human (GRCh38) Human (GRCh38)
Location 7:157902546-157902568 7:157902572-157902594
Sequence CCAGCCCCGCGGTGGTCTGGAGA CGTGGAAATCAACCTCACCGTGG
Strand - +
Off-target summary No data {0: 3, 1: 0, 2: 0, 3: 1, 4: 30}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!