ID: 1035316855_1035316860

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1035316855 1035316860
Species Human (GRCh38) Human (GRCh38)
Location 7:158001937-158001959 7:158001952-158001974
Sequence CCAGCCGGAAGCTGGCCAAGCTG CCAAGCTGTCTCCAGGTCCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 161} {0: 1, 1: 0, 2: 3, 3: 29, 4: 293}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!