ID: 1035349531_1035349537

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1035349531 1035349537
Species Human (GRCh38) Human (GRCh38)
Location 7:158236471-158236493 7:158236486-158236508
Sequence CCTCAAGCAAAGCTGCCCGAAGG CCCGAAGGTGGGGTCTGCCCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 18, 4: 232}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!