ID: 1035373395_1035373410

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1035373395 1035373410
Species Human (GRCh38) Human (GRCh38)
Location 7:158393038-158393060 7:158393083-158393105
Sequence CCCTGTGCCTGCTGCAGAGAAGG CTCTGCACCCCAGGTGGCCCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 55, 4: 431}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!