ID: 1035404279_1035404298

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1035404279 1035404298
Species Human (GRCh38) Human (GRCh38)
Location 7:158587872-158587894 7:158587924-158587946
Sequence CCGGACGCGCGTCCGCCCTCAGG GGCCACGCCCCCCGCCCGCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 66} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!