ID: 1035414034_1035414047

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1035414034 1035414047
Species Human (GRCh38) Human (GRCh38)
Location 7:158668090-158668112 7:158668124-158668146
Sequence CCCTCCGCCCTCCTTACCCACTA CGCCCTCCTTACCTACCCTCTGG
Strand - +
Off-target summary {0: 9, 1: 6, 2: 2, 3: 29, 4: 277} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!