ID: 1035419097_1035419102

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1035419097 1035419102
Species Human (GRCh38) Human (GRCh38)
Location 7:158712145-158712167 7:158712170-158712192
Sequence CCATATCCATGGGTCTGGCCTCA GACAACGTGAGCCAGAGTCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 181} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!