ID: 1035422500_1035422508

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1035422500 1035422508
Species Human (GRCh38) Human (GRCh38)
Location 7:158741415-158741437 7:158741454-158741476
Sequence CCAAAGCATGCCGGCCTCATGCT CTCTCCCCCAGCGTGGGGTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 94} {0: 1, 1: 0, 2: 1, 3: 36, 4: 660}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!