ID: 1035470412_1035470424

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1035470412 1035470424
Species Human (GRCh38) Human (GRCh38)
Location 7:159105628-159105650 7:159105674-159105696
Sequence CCATCACCAATCAGGGGCTCTGA GGGAGCCCCAGCAGGGTCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 136} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!