ID: 1035472212_1035472219

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1035472212 1035472219
Species Human (GRCh38) Human (GRCh38)
Location 7:159117687-159117709 7:159117715-159117737
Sequence CCACAGAGAGTGGCAGCTGAGGG GGCCCAGGAGGCCCGAGTCATGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 5, 3: 26, 4: 281}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!