ID: 1035635612_1035635614

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1035635612 1035635614
Species Human (GRCh38) Human (GRCh38)
Location 8:1141446-1141468 8:1141491-1141513
Sequence CCACACAGCTGATGGTTAGAAGA AAAAATGTAATCCAGAATGTTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!