ID: 1035875941_1035875946

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1035875941 1035875946
Species Human (GRCh38) Human (GRCh38)
Location 8:3189796-3189818 8:3189842-3189864
Sequence CCTTTAAATGGGTCATGAGCCAG AAACATGAGAAGTAACTCTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 11, 4: 89} {0: 1, 1: 0, 2: 1, 3: 22, 4: 269}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!