ID: 1036398210_1036398215

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1036398210 1036398215
Species Human (GRCh38) Human (GRCh38)
Location 8:8386417-8386439 8:8386432-8386454
Sequence CCGGCCGCGGGCGGGTGGCTTCT TGGCTTCTGCCTGGGCCCGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 80} {0: 1, 1: 0, 2: 6, 3: 68, 4: 707}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!