ID: 1036466555_1036466557

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1036466555 1036466557
Species Human (GRCh38) Human (GRCh38)
Location 8:9003101-9003123 8:9003114-9003136
Sequence CCGTGGCTCTCGCGCTGCTGGAG GCTGCTGGAGTCGCCGCGGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 148} {0: 1, 1: 0, 2: 0, 3: 13, 4: 290}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!