ID: 1036665892_1036665900

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1036665892 1036665900
Species Human (GRCh38) Human (GRCh38)
Location 8:10738110-10738132 8:10738136-10738158
Sequence CCCTGATCATTGTCTGGAGAAGG CCAGGCCATGATGCAGGGAAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 6, 3: 40, 4: 389}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!