ID: 1036840219_1036840222

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1036840219 1036840222
Species Human (GRCh38) Human (GRCh38)
Location 8:12115697-12115719 8:12115714-12115736
Sequence CCACCGCTAAGACCAAACGTCCT CGTCCTGTGCTGCCACCTCATGG
Strand - +
Off-target summary {0: 3, 1: 3, 2: 0, 3: 2, 4: 25} {0: 7, 1: 0, 2: 2, 3: 23, 4: 184}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!