ID: 1036930639_1036930643

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1036930639 1036930643
Species Human (GRCh38) Human (GRCh38)
Location 8:12952123-12952145 8:12952140-12952162
Sequence CCCCTGGCTGCGGGACAGCGCTG GCGCTGTGACTACTCGCAACGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 139} {0: 1, 1: 0, 2: 0, 3: 0, 4: 19}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!