ID: 1037313125_1037313130

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1037313125 1037313130
Species Human (GRCh38) Human (GRCh38)
Location 8:17577119-17577141 8:17577144-17577166
Sequence CCTTGTTCCTCCTGAAGAAACCG TCCTCCCGCTTCGGCGTCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 181} {0: 1, 1: 0, 2: 15, 3: 332, 4: 2488}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!