ID: 1037405252_1037405256

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1037405252 1037405256
Species Human (GRCh38) Human (GRCh38)
Location 8:18535791-18535813 8:18535820-18535842
Sequence CCTCTCTGACACGTTACGCTTGA CAGTGATTGGAGAAGTATCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 30} {0: 1, 1: 0, 2: 1, 3: 12, 4: 120}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!