ID: 1037545187_1037545193

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1037545187 1037545193
Species Human (GRCh38) Human (GRCh38)
Location 8:19913252-19913274 8:19913290-19913312
Sequence CCCAGTAGTCATTCAGGAGCAGG GTAGTTGAGCGGTTTTGAGTGGG
Strand - +
Off-target summary No data {0: 13, 1: 53, 2: 62, 3: 56, 4: 96}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!