ID: 1037569714_1037569724

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1037569714 1037569724
Species Human (GRCh38) Human (GRCh38)
Location 8:20148018-20148040 8:20148062-20148084
Sequence CCAAGCCCTGCATTGGGGCCAAT CAGAGGAACCTGCATGGGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 122} {0: 1, 1: 0, 2: 6, 3: 51, 4: 350}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!