ID: 1037824978_1037824988

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1037824978 1037824988
Species Human (GRCh38) Human (GRCh38)
Location 8:22155634-22155656 8:22155659-22155681
Sequence CCTGCCTTCACCAGGGTCCTCCC ATTGCCTCTTGGGGCACCCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 15, 3: 205, 4: 520} {0: 1, 1: 0, 2: 0, 3: 8, 4: 103}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!