ID: 1037885920_1037885927

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1037885920 1037885927
Species Human (GRCh38) Human (GRCh38)
Location 8:22596320-22596342 8:22596347-22596369
Sequence CCCCCTCTGGCTCTTGTTCTTTG GGCAGCCATCTCTCCTCCCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 59, 4: 592} {0: 1, 1: 1, 2: 2, 3: 31, 4: 281}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!