ID: 1037956998_1037957005

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1037956998 1037957005
Species Human (GRCh38) Human (GRCh38)
Location 8:23068116-23068138 8:23068146-23068168
Sequence CCAAGGAACCCCAAACAATGGCA TGAGCGGCCCCGCACGCGTAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 1, 4: 15}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!