ID: 1038220582_1038220586

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1038220582 1038220586
Species Human (GRCh38) Human (GRCh38)
Location 8:25603331-25603353 8:25603364-25603386
Sequence CCATTACCACTGAGCTATATTCT GAGCAGCTCATAGGCCAAGGTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!