ID: 1038351380_1038351386

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1038351380 1038351386
Species Human (GRCh38) Human (GRCh38)
Location 8:26779319-26779341 8:26779347-26779369
Sequence CCTTCCAAATTTTCCTTCTCCAT CCAACCCCAGCACTGCTGCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 61, 4: 652} {0: 1, 1: 0, 2: 2, 3: 57, 4: 340}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!