ID: 1038612514_1038612517

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1038612514 1038612517
Species Human (GRCh38) Human (GRCh38)
Location 8:29069294-29069316 8:29069309-29069331
Sequence CCATGCACGGTGGGCCTGGGGGC CTGGGGGCGTGGCTGCTGTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 290} {0: 1, 1: 0, 2: 2, 3: 38, 4: 458}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!