ID: 1038666557_1038666560

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1038666557 1038666560
Species Human (GRCh38) Human (GRCh38)
Location 8:29542698-29542720 8:29542721-29542743
Sequence CCCTCACTAAATTTAATAAGTGC TGGTATATCCAGTGCATTGTTGG
Strand - +
Off-target summary No data {0: 66, 1: 64, 2: 26, 3: 30, 4: 182}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!