ID: 1038811016_1038811018

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1038811016 1038811018
Species Human (GRCh38) Human (GRCh38)
Location 8:30843692-30843714 8:30843710-30843732
Sequence CCCTTTTTGTTTCTTCAAGCAAT GCAATTCAACTAATTGATCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 9, 3: 82, 4: 768} {0: 1, 1: 0, 2: 1, 3: 8, 4: 128}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!