ID: 1038811017_1038811018

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1038811017 1038811018
Species Human (GRCh38) Human (GRCh38)
Location 8:30843693-30843715 8:30843710-30843732
Sequence CCTTTTTGTTTCTTCAAGCAATT GCAATTCAACTAATTGATCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 44, 4: 648} {0: 1, 1: 0, 2: 1, 3: 8, 4: 128}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!