ID: 1038828460_1038828469

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1038828460 1038828469
Species Human (GRCh38) Human (GRCh38)
Location 8:31032887-31032909 8:31032905-31032927
Sequence CCCCCACGCCGGGCCCGGCTCCC CTCCCCCGGCGCCGCAGCGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 17, 3: 90, 4: 928} {0: 1, 1: 0, 2: 0, 3: 24, 4: 222}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!