ID: 1039056383_1039056389

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1039056383 1039056389
Species Human (GRCh38) Human (GRCh38)
Location 8:33540455-33540477 8:33540468-33540490
Sequence CCCAGTCATGGCCCTCTGGACAA CTCTGGACAAGTGGCAGGTCCGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 12, 4: 186}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!