ID: 1039282883_1039282892

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1039282883 1039282892
Species Human (GRCh38) Human (GRCh38)
Location 8:36006213-36006235 8:36006258-36006280
Sequence CCAGCTCATCTCGCTGGGACTGA GAGGGTGAACAGAAGCAGGGTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!