ID: 1039426877_1039426891

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1039426877 1039426891
Species Human (GRCh38) Human (GRCh38)
Location 8:37493507-37493529 8:37493554-37493576
Sequence CCCATTCTGTCACACAGACTCCA TGGGCCCCCTCTGCGAGACCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 321} {0: 1, 1: 0, 2: 2, 3: 11, 4: 102}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!