ID: 1039504731_1039504743

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1039504731 1039504743
Species Human (GRCh38) Human (GRCh38)
Location 8:38043732-38043754 8:38043773-38043795
Sequence CCAGCAGCTTCATAAGACCCCTG GATCTTGGTTCTCTTTGTGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 144} {0: 1, 1: 0, 2: 3, 3: 15, 4: 180}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!