ID: 1039595508_1039595518

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1039595508 1039595518
Species Human (GRCh38) Human (GRCh38)
Location 8:38787298-38787320 8:38787339-38787361
Sequence CCTGAGGAGGCCACAGGACGGGC GCCCGGCGCGGGGCCCGCTGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 269} {0: 1, 1: 1, 2: 4, 3: 38, 4: 309}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!