ID: 1039806199_1039806205

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1039806199 1039806205
Species Human (GRCh38) Human (GRCh38)
Location 8:41001795-41001817 8:41001847-41001869
Sequence CCTTCTTCCTTCTTCTTCTTCTT TCTTGCTAGATTACCCAGGCTGG
Strand - +
Off-target summary {0: 12, 1: 84, 2: 343, 3: 1478, 4: 5646} {0: 2, 1: 49, 2: 1670, 3: 14994, 4: 89227}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!