ID: 1039997488_1039997494

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1039997488 1039997494
Species Human (GRCh38) Human (GRCh38)
Location 8:42546469-42546491 8:42546516-42546538
Sequence CCCCATGGCTGGGGGTTATGGAG ATTATACTGTTCACGAAGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 168} {0: 1, 1: 0, 2: 0, 3: 2, 4: 57}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!