ID: 1040072084_1040072086

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1040072084 1040072086
Species Human (GRCh38) Human (GRCh38)
Location 8:43196568-43196590 8:43196583-43196605
Sequence CCTGGGCTTCTGCATTCCCTGCA TCCCTGCAGCAGTGGAGATGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 46, 4: 376} {0: 1, 1: 0, 2: 4, 3: 36, 4: 340}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!