ID: 1040415099_1040415110

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1040415099 1040415110
Species Human (GRCh38) Human (GRCh38)
Location 8:47188732-47188754 8:47188771-47188793
Sequence CCGCCACTGCCTGGAGCAGTCAC TTCCAGGAGCCGCCACCGCTGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 5, 3: 23, 4: 286} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!