ID: 1040601024_1040601032

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1040601024 1040601032
Species Human (GRCh38) Human (GRCh38)
Location 8:48883922-48883944 8:48883969-48883991
Sequence CCTGGCTCTGTGGCCAGAAAGAC GTCTGTCTTGTTGGGAGCTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 37, 4: 329} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!