ID: 1041390568_1041390574

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1041390568 1041390574
Species Human (GRCh38) Human (GRCh38)
Location 8:57343858-57343880 8:57343883-57343905
Sequence CCCGTATCAGCTAGGAAACCCAG CAAGCTACTTAAACTCTCAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 78} {0: 1, 1: 0, 2: 5, 3: 48, 4: 315}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!