ID: 1041792745_1041792754

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1041792745 1041792754
Species Human (GRCh38) Human (GRCh38)
Location 8:61714734-61714756 8:61714779-61714801
Sequence CCCCGCCCCTGCTCACTTAGGGC CTGTGAGCGCGAGCCTCTTTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 165} {0: 1, 1: 0, 2: 0, 3: 5, 4: 41}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!