ID: 1041823797_1041823804

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1041823797 1041823804
Species Human (GRCh38) Human (GRCh38)
Location 8:62068616-62068638 8:62068641-62068663
Sequence CCCATGACAGCTGCCGGGAGTGG CTGTACCCTGCAAAGTCACAGGG
Strand - +
Off-target summary No data {0: 58, 1: 1008, 2: 1533, 3: 1330, 4: 1060}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!