ID: 1042039943_1042039946

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1042039943 1042039946
Species Human (GRCh38) Human (GRCh38)
Location 8:64580346-64580368 8:64580371-64580393
Sequence CCTACTCAGAGATAATGATGTAA GACTCCCCCGTCTGTGGCGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 212} {0: 1, 1: 0, 2: 1, 3: 6, 4: 79}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!