ID: 1042281819_1042281829

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1042281819 1042281829
Species Human (GRCh38) Human (GRCh38)
Location 8:67064168-67064190 8:67064203-67064225
Sequence CCCCCACAGTTTAATAGCCCCTG GAACGAGTTGACCAAGTCCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 121} {0: 1, 1: 0, 2: 0, 3: 5, 4: 53}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!